Articles Tagged ‘ELISA-testi - BioNordika Oy’

Tuotteemme COVID-19 tutkimukseen ja diagnostiikkaan

SARS-CoV2: PCR- ja qPCR-pohjaiset tekniikat ja oheistuotteet

Potilasnäytteiden käsittely

BioServ UK valmistaa virusnäytteiden kuljetukseen ja säilytykseen steriiliä mediaa, jossa esim. koronavirusta sisältävät näytteet voi turvallisesti lähettää testaukseen. Tuote on CE-IVD -hyväksytty.

SARS-CoV-2:en detektio

BioServ UK:n valikoimissa on sekä CE-IVD-hyväksyttyjä että tutkimuskäyttöön suunniteltuja RT-PCR -testejä COVID-19 osoittamiseen. One-Step -testien etuna on, että testi voidaan tehdä suoraan eristetystä RNA:sta: testikitti sisältää kaiken tarvittavan.

Eurogentec tuottaa SARS-CoV-2 oligoja (WHO:n sekvenssit RdRP-geenille ja E-geenille) tutkimuskäyttöön ja ne ovat hyllyvalmiita 10 nmol alierissä, useassa eri kokonaisskaalassa. Oligot on tuotettu puhdastiloissa, mutta eivät ole ISO13485:en alaisia. Oligoille on tehty qPCR-kontrolli. Mikäli tuotteita halutaan käyttää diagnostiikassa, ne tulee itse validoida.

Eurogentec toimittaa myös räätälöityjä alukkeita ja koettimia nopealla aikataululla. Kysy lisää!

Geeni

Oligo

Oligon Sekvenssi (5’-3’)

Pituus (nt)

5’ Muokkaus

3’ Muokkaus

RdRP-geeni

RdRP_SARSr-F2

GTGARATGGTCATGTGTGGCGG

22

   

RdRP_SARSr-R1

CARATGTTAAASACACTATTAGCATA

26

   

RdRP_SARSr-P2

CAGGTGGAACCTCATCAGGAGATGC

25

FAM

BHQ-1

RdRP_SARSr-P1

CCAGGTGGWACRTCATCMGGTGATGC

26

FAM

BHQ-1

E-geeni

E_Sarbeco_F1

ACAGGTACGTTAATAGTTAATAGCGT

26

   

E_Sarbeco_R2

ATATTGCAGCAGTACGCACACA

22

   

E_Sarbeco_P1

ACACTAGCCATCCTTACTGCGCTTCG

26

FAM

BHQ-1

GenScriptin SARS-CoV-2 RT-qPCR-detektiotesti hyödyntää GenBank-sekvenssiä NC_045512.2. TaqMan™-kemiaan pohjautuva testi on Research use only –laatua ja targetoi ORF1ab-geeniä, RdRP-geeniä, N-geeniä ja E-geeniä. Testin mukana tulevat kaikki tarvittavat reagenssit (alukkeet, FAM-koettimet, muut reagenssit ja positiivinen kontrolliplasmidi).

Tutkimuksessa mielenkiintoinen pikadetektiovaihtoehto on NEB:in Colorimetric LAMP –kitti. LAMP-menetelmä on kenttäolosuhteisiin tarkoitettu tapa havaita näytteestä halutut geenialueet pH:n muutoksen ja sitä seuraavan värimuutoksen avulla. Menetelmä on isoterminen, eli esimerkiksi PCR-laitetta ei tarvita. SARS-CoV-2:en detektiossa negatiivinen näyte säilyy kirkkaan vaaleanpunaisena, mutta positiivinen näyte muuttuu keltaiseksi näytteen pH:n muuttuessa, kun polymeraasi monistaa SARS-CoV-2:en targetoituja geenialueita. Lue lisää kuinka väripohjaista LAMP -kittiä oli käytetty koronaviruksen (SARS-CoV-2, COVID-19) nopeaan detektioon.

Kaikki tarjoamamme SARS-CoV-2-detektiotuotteet on tarkoitettu ammattikäyttöön, eikä niitä tule käyttää esimerkiksi kotitestien tekemiseen.

Amplifiointi

Käänteistranskriptaasin ja PCR:n yhdistelmä (RT-PCR) mahdollistaa pientenkin RNA-määrien havaitsemisen näytteessä ja RNA:ta vastaavan cDNA:n syntetisoimisen.

cDNA-synteesiin liittyviä protokollia ja tuotteita löydät muun muassa NEB:ltä. Käänteistranskriptaaseja löytyy useita erilaisia, nopeimpana vaihtoehtona LunaScript, jolla cDNA-synteesi onnistuu kokonaisuudessaan vain 15 minuutissa.

NEB on myös tunnettu esimerkiksi korkean tarkkuuden Q5-polymeraasista, mutta muitakin tuotteita PCR:ään, qPCR:ään ja muuhun amplifiointiin löydät heidän sivuiltaan. Esimerkiksi Luna-qPCR-perheen uusin tulokas on Cell Ready –kitti, jonka avulla qPCR:n voi tehdä suoraan solususpensiosta lähtien ilman erillistä RNA-eristystä.

Jos sen sijaan haluat valmistaa DNA-kirjastoja NGS:ää varten, ethän unohda NEB:in mittavaa ja innovatiivista NEBNext-tuoteperhettä! Autamme kaikissa kysymyksissä mielellämme.

RNA:n eristys ja puhdistus

Voit eristää RNA:ta useista lähtömateriaaleista (veri, kudokset, solut, bakteerit, hiivat ja jopa kasvit) NEB:in Monarch Total RNA Miniprep -kitillä. Kitillä saat talteen myös pienet RNA:t (small RNA, alle 200 nt) ja teet gDNA-poiston halutessasi kahdesti. Kitin mukana tulee DNaasi I, proteinaasi K, RNA:n stabilointireagenssi ja gDNA:n poistopylväät. Tarjoamme kitin komponentit myös erikseen kaikissa Monarch-sarjan tuotteissa.

RNA-eristyksen lisäksi voit käyttää Monarch-sarjan tuotteita myös aiemmin eristetyn RNA:n puhdistukseen. Monarch RNA Cleanup –kitit mahdollistavat niin RNA:n puhdistuksen kuin konsentroinninkin ja RNA-saanto on 70 – 100 % jopa alle 20 ng näytemäärille. Tarjolla on puhdistusprotokollia 15 nt suuremmille RNA-fragmenteille.

Toinen toimittajamme nukleiinihappojen eristykseen on Invitek Molecular, jonka tarjoamat kitit ovat CE-IVD-hyväksyttyjä. Kolonnipohjainen viraalisen RNA:n eristyskitti soveltuu myös käsityönä tehtäviin eristyksiin, magneettihelmipohjaiset kitit on optimoitu puoliautomaattiseen eristykseen KingFisherillä.

Jos lähtömateriaali RNA-eristykseen on kudosta tai soluja, Porvairin uudet Chromatrap-homogenointipylväättarjoavat nopean tavan puhdistaa näyte debriksestä ennen eristystä.

Toimitamme uutta RNA-lyysis -puskuria, joka soveltuu käytettäväksi magneettihelmipohjaisten automaattisten eristyslaitteiden, esim. MagnaPure, kanssa. Pyydä näyte validoitavaksi!

Toimitamme yhteensopivia 96-levyjä MagNA Pure 96-laitteistoon – kysy lisää!

SARS-CoV2: Vasta-ainepohjaiset tekniikat ja oheistuotteet

Toisin kuin nukleiihihappoihin perustuvat testausmenetelmät, serologiset testit kertovat, onko henkilö sairastanut taudin hiljattain. Toimittajamme Genscriptin tuotanto tapahtuu pääsääntöisesti Kiinassa, ja heillä on siksi hieman etumatkaa tuotekehityksessä. Genscript on tuonut markkinoille kaksi Elisa-pohjaista testiä, jotka osoittavat SARS-CoV-2 Spike-proteiinin reseptoriin sitoutuvaan osaan (RBD) sitoutuvia vasta-aineita. Toinen testeistä osoittaa sekä infektion alkuvaiheessa nousevat IgM-vasta-aineet että hiljattain sairastetusta infektiosta kertovat IgG-vasta-aineet, toinen on IgG-spesifinen. Nämä eivät ole kliiniseen diagnostiikkaan validoituja testejä. 

BioServ UK:lta toimitamme vasta-ainepohjaisia pikatestejä sekä ELISA-testejä, sekä IVD- että tutkimuskäyttöön.

Genscriptiltä saa myös SARS-CoV-2 S1 RBD -vasta-ainetta ja puhdistettuja virusproteiineja, joita on tuotettu eri isäntäsoluissa, myös eri tageilla varustettuina. Myös Cayman Chemicalsilta ja Origenelta löytyy erilaisia virusproteiineja ja SARS-CoV-2 vasta-aineita.

Viruksen infektoitumisreittien tutkimiseen usealta toimittajaltamme löytyy työkaluja. ACE2-reseptoriin liittyvään tutkimukseen Origene tarjoaa laajan valikoiman mm. vasta-aineita, cDNA-klooneja, siRNA-tuotteita ja CRISPR-kittejä. Anaspecin SensoLyte 390 ACE2 Activity Assay Kit soveltuu ACE2-inhibiittoreiden ja indusoijien skriinaamiseen. Myös CST:lta on saatavilla hACE2-vasta-aine Western- ja IP-käyttöön ja paljon muuta esim. immuunivasteen ja tulehdusreaktion tutkimiseen. Lue lisää tutkimustyökaluista CST:n SARS-CoV-2 -sivuilta, CST:n blogista ja Origenen COVID-19 -sivustolta. 50% kampanjatarjous pandemiatutkimukseen osallistuville on voimassa 29.5.2020 saakka - hae kampanjakoodisi täältä!

Lonza on maailmanlaajuisesti suurimpia primaarisolujen toimittajia, jonka valikoimassa on useita eri hengityselinperäisiä soluja, kuten keuhkon epiteelisoluja, fibroblasteja ja sileitä lihassoluja, pienten ilmatiehyiden epiteelisoluja, keuhkojen mikrovaskulaarisoluja ja keuhkovaltimon endoteelisoluja, sekä primaarisoluja muista ACE2-ekspressoivista kudoksista, kuten sydämestä ja ohutsuolesta. Monia solutyyppejä on saatavilla myös diabeettisilta ja astmaattisilta luovuttajilta.  Jos tutkimus kohdistuu immuunivasteeseen, laaja valikoima hematopoieettisia soluja, kuten PBMC-, T- ja B-soluja, on saatavilla kauttamme. Lonzalta löytyy myös solukohtaisesti optimoidut kasvatusmediat.

Tutkimusreagensseja mahdollisten terapiareittien selvittämiseen

Toistaiseksi SARS-CoV-2 infektion hoitamiseen ei ole lääkkeitä, mutta Cayman Chemicals on koonnut yhteen tietoa muista FDAn hyväksymistä lääkeaineista, joiden vaikutusmahdollisuuksia tutkitaan koronavirusinfektion hoidossa. Nämä lääkeaineet on valittu tarkasteltavaksi niiden virus-reseptorivaikutusten tai viruksen monistumiseen liittyvien, tiedettyjen vaikutusmekanismiensa vuoksi. Influenssalääke favilavir ja Ebola-viruslääke remdesivir ovat ensimmäisten tutkittavien kandidaattien joukossa.

SARS-CoV-2 on RNA-virus, jonka pääsy soluun näyttää perustuvan samaan, osin tunnettuun mekanismiin kuin aiemmin epidemian aiheuttaneen SARS-CoV -viruksen. Virus hyödyntää ACE2 (angiotensin converting enzyme 2) -reseptoria, joita on erityisen paljon keuhkojen epiteelisoluissa. Viruksen kuoren proteiini (spike) säätelee ACE2-reseptoriin sitoutumista ja endosytoosia, mutta siihen vaikuttaa myös isäntäsolun furiini-entsyymin toiminta. Furiinia ekspressoidaan muissakin kudoksissa kuin keuhkoepiteelissä, mm. maksasoluissa ja ohutsuolessa. Anaspecin furiini- ja katepsiinikitit tarjoavat työkaluja viruksen fuusioitumisen ja replikaation tutkimiseen. Erilaisten kasviperäisten lektiinien kykyä estää koronaviruksen kiinnittymistä isäntäsolun pintaan ja niiden muita antiviraalisia ominaisuuksia voidaan mahdollisesti hyödyntää terapiakehityksessä. 

Tutkimus kohdistuu mm. viruksen ja isäntäsolun fuusioitumisen inhibiittoreihin, proteaasi-inhibiittoreihin, jotka estävät solussa virusproteiinien pilkkomisen toimivaan muotoon ja siten viruksen replikoitumisen, RNA-riippuvaisiin RNA-polymeraasi-inhibiittoreihin sekä endosomaalisen pH:n säätelyyn, johon esim. malarialääke klorokiini vaikuttaa. Toimittamamme reagenssit on tarkoitettu ainoastaan tutkimuskäyttöön.

Muita työkaluja toimittajiltamme

Greinerin valikoimassa on kaikki laboratorion perusmuovituotteet, kuten PCR- ja ELISA-levyt. Laitetoimittajistamme Genevacin sentrifugaalihaihduttimet ja Virtiksen kylmäkuivurit soveltuvat erilaisten testikittien valmistukseen. Ziathin viivakoodilukijat helpottavat näytteenkäsittelyn automaatiota. Kauttamme saat myös Bradyn merkintätuotteet, myös kylttitulostukseen. 
Työpaikkaturvallisuus Brady

cell immuno instruments custom